ENG Adenovirus (Rat)

  • Retired Cat.No.

    19287056
  • Product Name

    ENG Adenovirus (Rat)
  • Unit

    1.0 ml
  • Description

    This adenovirus is part of abm’s Adenoviral Expression System and can be used directly to transiently over-express your gene of interest in a wide range of host cells. This adenovirus can be used to amplify more adenovirus by transducing HEK293 cells.
  • Gene Name/Gene ID

    ENG, 497010
  • Gene Full Name

    endoglin
  • Alias

    END, HHT1, CD105
  • Accession Number

  • Species

    Rat
  • Titer

    >1x106pfu/mL
  • System

    Adenovirus
  • Promoter

    CMV
  • Insert Size

    1953
  • Vector Size

    32908
  • Storage Condition

    Storage Buffer: DMEM with 10% glycerol.

    Upon arrival, store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.

  • Disclaimer

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using A619287? Please let us know so that we can cite the reference in this datasheet.
    A619287 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.

    MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    5’ tacccatacgacgtcccagactacgct 3’

    5’ YPYDVPDYA 3’
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Nov 13 2025
    Answer
    Yes, a Kozak sequence (GCCGCCACCATGG) immediately upstream of the ATG is required to ensure optimal protein translation. This is true for all mammalian expression vectors that we offer. Please note that blank vector/viruses do not express anything so the Kozak sequence will be absent.
    ABM Scientific Support
    Answered on Nov 13 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Serum-free DMEM + 10% glycerol
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    1. This often happens to primary cells which are very sensitive to culture medium conditions. Try to use a higher titer virus in order to limit the volume of exogenous media added to your cells.
    2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
    3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
    4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 05 2026
    Answer
    abm’s adenoviruses are first generation and are based on the human adenovirus serotype 5 (Ad5).
    ABM Scientific Support
    Answered on Jan 05 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A complete list of controls can be found on abm’s Control Vectors and Viruses page.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    There could several reasons for this:
    1. qPCR detection is much more sensitive than Western blot, and any target signal is amplified greatly during qPCR.
    2. Verify that your primary antibody is of good quality and include good positive and negative controls in your Western blot.
    3. Western blot can only be performed after a stable cell line has been established and notably it rarely works well with a polyclonal cell culture.
    4. mRNA expression does not always correlate with protein expression because many different biological factors may affect translation, including protein half-life, protein degradation and molecular processes such as phosphorylation, ubiquitination, methylation, etc. abm is not in a position to guarantee GOI expression at the protein level due to the number of experimental variables involved. abm guarantees GOI expression at the mRNA level only, while expression at the protein level must be determined experimentally. We recommend checking the literature to see whether other scientists have been able to over-express the protein in the same target cells and how this was achieved (tag, delivery system, detection method, etc).
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    Each viral vector system has different strengths depending on the application:
    The best choice depends on target cells, expression duration, payload size, and safety requirements.
    ABM Scientific Support
    Answered on Jan 16 2026
    ABM community
    Verified customer
    Asked on Jan 16 2026
    Answer
    Vector selection depends on several practical factors:
    If customers are unsure, we recommend sharing target cell type, payload size, and desired expression duration so we can suggest the most appropriate approach.
    ABM Scientific Support
    Answered on Jan 16 2026
    Answer
    • Confirm vector delivery: Verify successful transfection or transduction using a reporter, marker, or control vector.

    • Check expression at multiple levels: Confirm expression at the RNA level (e.g., transcript detection) as well as protein level, since post-transcriptional regulation may occur.

    • Consider cell type effects: CMV promoter activity can vary between cell lines and may be weak or silenced in certain cells.

    • Evaluate gene-specific factors: Some genes are toxic, unstable, or tightly regulated, which can reduce detectable overexpression.

    • Review culture and timing: Expression levels may depend on cell health, passage number, and time post-delivery.

    • Validate construct design: Ensure the insert is in the correct orientation, reading frame, and matches the expected sequence.

    ABM Scientific Support
    Answered on Jan 29 2026
    Answer

    Differences between the observed and expected molecular weight are relatively common and can result from several factors, including alternative splicing, post-translational modifications, proteolytic processing, or the presence of fusion tags. In some cases, the antibody may also recognize non-specific proteins.

    Basic troubleshooting steps include:

    • Confirming the predicted protein size, including any tags or signal peptides.

    • Verifying antibody specificity and reviewing the datasheet for known cross-reactivity.

    • Checking whether the protein undergoes cleavage or modification in your cell type.

    • Comparing expression to a positive control or reference sample.

    • Confirming construct sequence and reading frame.

    ABM Scientific Support
    Answered on Jan 29 2026
    Answer

    Lack of GFP expression can occur even when delivery appears successful. Expression levels may be influenced by cell type, promoter activity, transduction efficiency, or cellular stress. In some cells, CMV or other strong promoters may be silenced, and high MOI can negatively impact cell health.

    Basic troubleshooting steps include:

    • Confirming successful delivery using an alternative marker or control construct.

    • Assessing cell viability and morphology after transduction.

    • Allowing sufficient time post-delivery for expression.

    • Evaluating whether the promoter is active in your specific cell line.

    • Verifying construct integrity and GFP coding sequence.

    Because expression outcomes are highly system-dependent, optimization may be required for each experimental setup.

    ABM Scientific Support
    Answered on Jan 29 2026
    Prev
    Next
    There are currently no reviews for A619287.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
ENG Adenovirus (Rat)
Cat. No.
A619287
Customize Vector
Virus Packaging Services
Adenovirus Titer Upgrade to 1010 pfu/ml (Add-on)
2 x 1 ml
$445.00
Adenovirus Titer Upgrade to 1012 pfu/ml (Add-on)
5 x 200 µl
$1,875.00
Controls and Related Products
Cre-GFP Adenovirus
000023A
1.0 ml
$350.00
Adeno CMV Null Adenovirus
000047A
1.0 ml
$350.00
GFP Adenovirus
000541A
1.0 ml
$350.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
Cre-GFP Adenovirus
000023A
1.0 ml
$350.00
Adeno CMV Null Adenovirus
000047A
1.0 ml
$350.00
GFP Adenovirus
000541A
1.0 ml
$350.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
ENG Adenovirus (Rat)
A619287
Adenovirus Packaging at 1010 pfu/ml Titer
AD10-A619287
Adenovirus Packaging at 1012 pfu/ml Titer
AD12-A619287
;