MT-CO3 ORF Vector (Human)

  • Product Name

    MT-CO3 ORF Vector (Human)
  • Unit

    1.0 µg DNA
  • Description

    The MT-CO3 ORF Vector holds the gene (cloned by a restriction enzyme-independent method) between an AflII and EcoRV cut site. Inserts are flanked by and can be excised using AflII and EcoRV as long as inserts do not contain any internal AflII and EcoRV sites. In the case that the insert contains these internal cut sites, the end user can PCR amplify the insert with preferred restriction sites for subcloning.

    atgacccaccaatcacatgcctatcatatagtaaaacccagcccatgacccctaacaggg
    gccctctcagccctcctaatgacctccggcctagccatgtgatttcacttccactccata
    acgctcctcatactaggcctactaaccaacacactaaccatataccaatgatggcgcgat
    gtaacacgagaaagcacataccaaggccaccacacaccacctgtccaaaaaggccttcga
    tacgggataatcctatttattacctcagaagtttttttcttcgcaggatttttctgagcc
    ttttaccactccagcctagcccctaccccccaattaggagggcactggcccccaacaggc
    atcaccccgctaaatcccctagaagtcccactcctaaacacatccgtattactcgcatca
    ggagtatcaatcacctgagctcaccatagtctaatagaaaacaaccgaaaccaaataatt
    caagcactgcttattacaattttactgggtctctattttaccctcctacaagcctcagag
    tacttcgagtctcccttcaccatttccgacggcatctacggctcaacattttttgtagcc
    acaggcttccacggacttcacgtcattattggctcaactttcctcactatctgcttcatc
    cgccaactaatatttcactttacatccaaacatcactttggcttcgaagccgccgcctga
    tactggcattttgtagatgtggtttgactatttctgtatgtctccatctattgatgaggg
    tctt

  • Gene Name/Gene ID

    MT-CO3, 4514
  • Gene Full Name

    mitochondrially encoded cytochrome c oxidase III
  • Alias

    COX3, COIII, CO3
  • Accession Number

  • Species

    Human
  • System

    Non-Viral Vector
  • Insert Size

    784
  • Vector Size

    2596
  • Storage Condition

    Store ORF Vectors at -20°C.

  • Disclaimer

  • Guarantee

    abm guarantees that the correct ORF construct is provided. If this is not the case, we will provide a one-time replacement. The replacement will not be covered by the same guarantee.

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using PC130779? Please let us know so that we can cite the reference in this datasheet.
    PC130779 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Typically vectors are supplied at 100ng/µl.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A general Plasmid Amplification Protocol can be found here.

    We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
    2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
    3. Place the plate “agar side up” and incubate at 37°C overnight.
    4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    • Verify plasmid quality: Confirm the plasmid is intact, at sufficient concentration, and free of contaminants (e.g., salts, ethanol, nucleases).

    • Check the host strain: Use a suitable cloning strain (e.g., recA⁻/endA⁻ such as DH5α) and confirm cells are competent and not expired.

    • Confirm selection conditions: Make sure the correct antibiotic is used at the proper concentration and that plates/media are fresh.

    • Review transformation conditions: Ensure the transformation method (chemical or electrocompetent) and recovery time are appropriate.

    • Assess plasmid compatibility: Large, low-copy, toxic, or unstable plasmids may require specialized strains or growth conditions.

    • Inspect growth conditions: Verify incubation temperature, shaking speed, and culture time.

    • Check plasmid sequence/features: Look for toxic genes, strong promoters, or repeats that may reduce stability.

    ABM Scientific Support
    Answered on Jan 29 2026
    There are currently no reviews for PC130779.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
MT-CO3 ORF Vector (Human)
Cat. No.
PC130779
Plasmid DNA Services
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Controls and Related Products
Column-Pure Gel and PCR Clean-Up Kit
D516
100 Preparations
$180.00
Pro Ligation-Free Cloning MasterMix
G4004
50 Reactions
$258.00
MegaFi™ Pro Fidelity 2X PCR MasterMix
G887
800 rxn (10.0 ml)
$335.00
SafeView™ Classic
G108
1.0 ml
$78.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
Column-Pure Gel and PCR Clean-Up Kit
D516
100 Preparations
$180.00
Pro Ligation-Free Cloning MasterMix
G4004
50 Reactions
$258.00
MegaFi™ Pro Fidelity 2X PCR MasterMix
G887
800 rxn (10.0 ml)
$335.00
SafeView™ Classic
G108
1.0 ml
$78.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
;