OLR910 Adenovirus (Rat)
Olr910 CRISPR
Olr910 Lentiviral
Olr910 AAV
Olr910 Adenovirus
Olr910 ORF
Olr910 siRNA
-
Retired Cat.No.
34779056 -
Product Name
OLR910 Adenovirus (Rat) -
Unit
1.0 ml -
Description
This adenovirus is part of abm’s Adenoviral Expression System and can be used directly to transiently over-express your gene of interest in a wide range of host cells. This adenovirus can be used to amplify more adenovirus by transducing HEK293 cells. -
Gene Name/Gene ID
Olr910, 288803 -
Gene Full Name
olfactory receptor 910 -
Accession Number
-
Species
Rat -
Titer
>1x106pfu/mL -
System
Adenovirus -
Promoter
CMV -
Insert Size
936.0 -
Vector Size
32908 -
Storage Condition
Storage Buffer: DMEM with 10% glycerol.
Upon arrival, store the viruses at -80°C in small aliquots to avoid repeated freeze-thaw cycles.
-
Disclaimer
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Publishing research using A634779? Please let us know so that we can cite the reference in this datasheet.
A634779 has not been cited in any literature.
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
5’ tacccatacgacgtcccagactacgct 3’
5’ YPYDVPDYA 3’
5’ YPYDVPDYA 3’
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Nov 13 2025
Answer
Yes, a Kozak sequence (GCCGCCACCATGG) immediately upstream of the ATG is required to ensure optimal protein translation. This is true for all mammalian expression vectors that we offer. Please note that blank vector/viruses do not express anything so the Kozak sequence will be absent.
ABM Scientific Support
Answered on Nov 13 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Serum-free DMEM + 10% glycerol
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
1. This often happens to primary cells which are very sensitive to culture medium conditions. Try to use a higher titer virus in order to limit the volume of exogenous media added to your cells.
2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 05 2026
Answer
abm’s adenoviruses are first generation and are based on the human adenovirus serotype 5 (Ad5).
ABM Scientific Support
Answered on Jan 05 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
A complete list of controls can be found on abm’s Control Vectors and Viruses page.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
There could several reasons for this:
1. qPCR detection is much more sensitive than Western blot, and any target signal is amplified greatly during qPCR.
2. Verify that your primary antibody is of good quality and include good positive and negative controls in your Western blot.
3. Western blot can only be performed after a stable cell line has been established and notably it rarely works well with a polyclonal cell culture.
4. mRNA expression does not always correlate with protein expression because many different biological factors may affect translation, including protein half-life, protein degradation and molecular processes such as phosphorylation, ubiquitination, methylation, etc. abm is not in a position to guarantee GOI expression at the protein level due to the number of experimental variables involved. abm guarantees GOI expression at the mRNA level only, while expression at the protein level must be determined experimentally. We recommend checking the literature to see whether other scientists have been able to over-express the protein in the same target cells and how this was achieved (tag, delivery system, detection method, etc).
1. qPCR detection is much more sensitive than Western blot, and any target signal is amplified greatly during qPCR.
2. Verify that your primary antibody is of good quality and include good positive and negative controls in your Western blot.
3. Western blot can only be performed after a stable cell line has been established and notably it rarely works well with a polyclonal cell culture.
4. mRNA expression does not always correlate with protein expression because many different biological factors may affect translation, including protein half-life, protein degradation and molecular processes such as phosphorylation, ubiquitination, methylation, etc. abm is not in a position to guarantee GOI expression at the protein level due to the number of experimental variables involved. abm guarantees GOI expression at the mRNA level only, while expression at the protein level must be determined experimentally. We recommend checking the literature to see whether other scientists have been able to over-express the protein in the same target cells and how this was achieved (tag, delivery system, detection method, etc).
ABM Scientific Support
Answered on Mar 24 2025
Prev
Next
There are currently no reviews for A634779.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
OLR910 Adenovirus (Rat)
Cat. No.
A634779
Virus Packaging Services
Adenovirus Titer Upgrade to 1010 pfu/ml (Add-on)
2 x 1 ml
$445.00
Adenovirus Titer Upgrade to 1012 pfu/ml (Add-on)
5 x 200 µl
$1,875.00
Controls and Related Products
Cre-GFP Adenovirus
000023A
1.0 ml
$350.00
Adeno CMV Null Adenovirus
000047A
1.0 ml
$350.00
GFP Adenovirus
000541A
1.0 ml
$350.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
Current vector selected:
OLR910 Adenovirus (Rat)
Cat. No.
A634779
Controls and Related Products
Cre-GFP Adenovirus
000023A
1.0 ml
$350.00
Adeno CMV Null Adenovirus
000047A
1.0 ml
$350.00
GFP Adenovirus
000541A
1.0 ml
$350.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
OLR910 Adenovirus (Rat)
A634779
Adenovirus Packaging at 1010 pfu/ml Titer
AD10-A634779
Adenovirus Packaging at 1012 pfu/ml Titer
AD12-A634779