FZD7 siRNA AAV Vector Set (Mouse)

  • Retired Cat.No.

    21114164
  • Product Name

    FZD7 siRNA AAV Vector Set (Mouse)
  • Unit

    4 x 500 ng DNA
  • Description

    abm's RNAi expression vectors and viruses are ready-to-use tools for siRNA-mediated gene knockdown. Each product set includes four pre-designed siRNA vectors targeting your gene’s mRNA to ensure effective gene silencing. Both siRNA and shRNA constructs are available with the shRNA option accessible through the DNA Preparation Options. For added flexibility, our siRNA/shRNA vectors and viruses are also available in Lentivirus and AAV formats.
  • Gene Name/Gene ID

    FZD7, 14369
  • Gene Full Name

    frizzled homolog 7 (Drosophila)
  • Alias

    FzE3
  • Accession Number

  • Species

    Mouse
  • System

    AAV Vector
  • Target Sequence

    288: TGAGCTACGCTTCTTCTTATGCTCTATGT
    712: AACGGCCTCATGTACTTTA
    812: TCACCTACCTAGTGGACATGC
    1116: CGAGGCCAACTCGCAGTACTTTCATCTGG
  • Vector Size

    6013
  • Storage Condition

    Store AAV Vectors at -20°C.
  • QC

    Restriction enzyme digest and sequencing.
  • Disclaimer

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using VS421114? Please let us know so that we can cite the reference in this datasheet.
    VS421114 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    We recommend using abm’s 2nd Generation Packaging System Mix (Cat. No. LV003) or 3rd Generation Packaging System Mix (Cat. No. LV053). abm’s lentiviral vectors have been tested and are compatible with Invitrogen’s packaging mix; we have not tested other suppliers and cannot guarantee compatibility.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.

    MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    The concentration must be optimized for each cell type.  Typical selection amounts are around 0.1 - 0.5µg per ml.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Our scramble negative control can be used for human, mouse and rat. Please refer to abm’s Control Vectors and Viruses webpage for a full list.
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    We recommend testing all 4 siRNA vectors. abm guarantees that at least one out of the four vector constructs purchased in a set will result in over 70% knockdown of gene expression within target cells showing >80% transfection efficiency.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    These vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop – this is to avoid any possible recombination events that can occur.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes.
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    Since every gene is different, it is best to optimize the transfection condition to allow for the most siRNA vector used without causing toxicity. We recommend transfecting a range of siRNA vector starting at 2µg.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Aug 08 2025
    Answer
    abm's lentiviral vectors are compatible with 2nd and 3rd generation packaging systems. We recommend abm’s Second Generation Packaging Mix (Cat. No. LV003) for users who want to achieve higher titer lentivirus as only 3 plasmids are required for virus production instead of 4 plasmids.  We also recommend abm’s Third Generation Packaging Mix (Cat. No. LV053) for users concerned with virus biosafety, as the viral packaging elements are further split into 4 plasmids thus reducing probably of producing wild type virus.

    Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
    ABM Scientific Support
    Answered on Aug 08 2025
    Answer
    Since lentivirus is an RNA virus, during the synthesis of the RNA genome to be packaged, if there is a polyadenylation signal in the insert, the RNA will be terminated prematurely. There is a SV40 poly(A) signal in the vector located downstream of the 3'LTR. It is designed this way to ensure a high amount of transcriptional RNA is present so that a high viral titer is obtained. We have received positive feedback from previous customers in regards to the high and stable expression levels of our lentivectors.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Typically vectors are supplied at 100ng/µl.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    We recommend packaging each vector separately. This way, each one can be assessed for quality prior to pooling them together.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    Yes, all of abm’s lentiviral vectors contain the WPRE (woodchuck hepatitis virus post-transcriptional regulatory element) upstream of the 3’LTR. This element when transcribed creates a tertiary structure which enhances gene expression.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    siRNA and shRNA achieve the same goal of silencing gene expression by cleaving the target miRNA. However, their differences are as follows:

    1. siRNA (small interfering RNA) is a linear sequence that binds to the target mRNA and cleaves it, preventing the unwanted protein from being made
    2. shRNA (short hairpin RNA) is a DNA construct encoding a sequence of single stranded RNA and its complement, separated by a stuffer fragment, allowing the RNA molecule to fold back on itself, creating a hairpin loop.
    3. Traditionally, siRNA is made synthetically and introduced into the cells resulting in rapid, short term effect. shRNA is cloned into a vector and then introduced into the cell's genome, which can prolong expression.
    4. shRNA poses a difficulty on amplification and sequencing and thus it is not easy to construct. abm has come up with a novel technology where we combined the ability to clone siRNA into a vector, but with the same effect as shRNA. With the help of a dual convergent promoter vector system, the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop, which thus avoids any possible recombination events that can occur. The siRNA sequence is expressed in both directions, and therefore mimicks the actions of shRNA.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    These are both units used to measure the titer of AAV and can be used interchangeably. They are both based on qPCR methods.
    •GC/ml = Genome copies per milliliter, a physical titer that measures the number of genome-containing particles in a given volume.
    •vg/ml = Vector genomes per milliliter, a measure of the number of vector genomes in a given volume.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    It is possible that the incorrect AAV serotype was chosen. Serotype selection is an important parameter affecting transduction ability of AAV particles. In other words, you must determine which serotype works best for your cell line.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    10^7 IU/ml = DMEM
    10^8, 10^9, 10^10 IU/ml = 1X PBS (pH 7.4) with 2% PEG6000
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 28 2025
    Answer
    10^11 GC/ml = 1X PBS (pH 7.4)
    10^12, 10^13 GC/ml = 1X PBS (pH 7.4)+10% glycerol
    ABM Scientific Support
    Answered on Mar 28 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A general Plasmid Amplification Protocol can be found here.

    We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
    2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
    3. Place the plate “agar side up” and incubate at 37°C overnight.
    4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    We recommend first checking the following parameters:
    1. Cell density. If density is too low, this can also result in cell death.
    We recommend the following experiments:
    Initial Experiment
    •Transduce lentivirus into the 293T cell line - one of the easiest cell lines to transduce. If the transduced cells survive selection, then troubleshooting should focus on post-virus production steps. If the transduced cells didn't survive selection, the troubleshooting should focus on virus packaging steps.
    Virus Packaging Troubleshooting
    •Attempt lentivirus packaging using a GFP expressing control vector. If packaging is successful with the control, then repeat packing of the lentivirus in question with a GFP batch control to ensure no errors with the first production. If no GFP signal is observed after transfection or ~72h after a test transduction of a GFP control lentivirus on 293T cells, then the packaging process needs to be assessed.  Packaging process assessment includes reagent quality, cell health, and packaging protocol details.
    Post-Virus Production Troubleshooting
    •Assess if the correct antibiotic concentration is used. This can be done by performing a drug-killing curve. To set up a drug-killing curve, we recommend using the same culture size and seeding density for your actual selection, and adding a different puromycin concentration to each sample, with the range between 0-1 ug/ml. If the cells are not killed at the 1ug/ml, you may try increasing the range higher concentrations. It is important to identify the concentration that results in >95% cell death in 1-4 days to establish the minimal concentration to use for the selection process.
    •Assess if the correct MOI is used to transduce the target cells. This can be done by using a GFP control lentivirus to transduce the target cells at a range around literature-recommended MOIs to determine the optimal MOI for transduction.
    •Assess if a transduction enhancer such as the ViralEntry Transduction Enhancer (Cat.No. G515) is necessary. Some cell lines are more difficult to transduce than others and by using a transduction enhancer can lead to increased target cell permeability.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    1. This often happens to primary cells which are very sensitive to culture medium conditions. Try to use a higher titer virus in order to limit the volume of exogenous media added to your cells.
    2. Virus preparation might be contaminated with bacteria. Use a 0.25µm syringe filter to clear the virus preparation and repeat transduction following strict sterile technique.
    3. Cell line might be contaminated with mycoplasm. This type of contamination is often not immediately obvious. The contamination effect is amplified after virus transduction. Repeat transduction with fresh cells.
    4. The virus preparation may contain some cell debris which could be mistaken as a change in cell morphology. Normally this issue will disappear 3-5 days after virus transduction.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    AAV exhibits natural tropism towards certain cells and tissue types. Therefore your choice of AAV serotype should be dependent on the desired cell type. See our AAV Serotype Selection Chart at this link. Alternatively abm offers an AAV Serotype Blast Kit (Cat. No. AAV099) containing 9 pre-packaging helper-free AAV with GFP expression. This kit can be used to help the user determine a suitable serotype for their desired cell line.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A complete list of controls can be found on abm’s Control Vectors and Viruses page.
    ABM Scientific Support
    Answered on Jan 30 2026
    Answer
    There could many possible reasons for this result.
    1. Typically GFP is behind a weaker promoter such as SV40 or CBH leading to a less robust fluorescence signal.
    2. Virus titer is low leading to only a small proportion of successfully transduced cells. Try increasing the MOI or using a transduction enhancer such as abm’s ViralEntry™ (Cat.No. G516). 3. Target cells are difficult to transduce. A higher MOI must be tested. Some cells are very easy to be transduced such as 293T, while others such as lymphocytes are very difficult.
    4. Lentivirus became inactivated during transportation and storage. Lentivirus is very sensitive to temperature changes. Leaving lentivirus at room temperature, 4°C for 48 hours, or subjecting it to multiple freeze/thaws can lead to inactivation or reduced titer.
    ABM Scientific Support
    Answered on Mar 24 2025
    Answer
    Transfection of cell lines such as 293T can achieve very high efficiency – near 100%. Thus it is possible to achieve good siRNA gene knock down via transfection. However, you will not have a stable cell line. With lentivirus, you will need to establish a stable cell line where 100% of the cells express the siRNA. Without a pure stable cell line, you will not see efficient gene knock down effects.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 16 2026
    Answer
    AAV serotypes have different tropisms (preferred target tissues/cell types), so selecting the right serotype can significantly improve transduction efficiency. In general:
    Because transduction efficiency can vary by model system, promoter, dose, and delivery route, we recommend customers consult publications using the same target cell type/tissue and testing more than one serotype when possible.
    ABM Scientific Support
    Answered on Jan 16 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    • Verify plasmid quality: Confirm the plasmid is intact, at sufficient concentration, and free of contaminants (e.g., salts, ethanol, nucleases).

    • Check the host strain: Use a suitable cloning strain (e.g., recA⁻/endA⁻ such as DH5α) and confirm cells are competent and not expired.

    • Confirm selection conditions: Make sure the correct antibiotic is used at the proper concentration and that plates/media are fresh.

    • Review transformation conditions: Ensure the transformation method (chemical or electrocompetent) and recovery time are appropriate.

    • Assess plasmid compatibility: Large, low-copy, toxic, or unstable plasmids may require specialized strains or growth conditions.

    • Inspect growth conditions: Verify incubation temperature, shaking speed, and culture time.

    • Check plasmid sequence/features: Look for toxic genes, strong promoters, or repeats that may reduce stability.

    ABM Scientific Support
    Answered on Jan 29 2026
    Prev
    Next
    There are currently no reviews for VS421114.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
FZD7 siRNA AAV Vector Set (Mouse)
Cat. No.
VS421114
Plasmid DNA Services
Upgrade to shRNA
1 Service
$150.00
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Virus Packaging Services
AAV packaging (Serotype 1) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 2) 1011 GC/ml ,pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 3) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 4) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 5) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 6) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 7) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 8) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 9) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 10) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 11) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 1) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 2) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 3) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 4) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 5) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 6) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 7) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 8) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 9) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 10) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 11) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 1) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 2) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 3) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 4) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 5) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 6) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 7) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 8) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 9) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 10) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 11) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV serotypes 3, 4, and 6 typically produce lower yields compared to other serotypes. As such, we can only guarantee 50% of the minimum titers listed in the table above.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
FZD7 siRNA AAV Vector Set (Mouse)
VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 1)
iAV111-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 2)
iAV112-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 3)
iAV113-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 4)
iAV114-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 5)
iAV115-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 6)
iAV116-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 7)
iAV117-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 8)
iAV118-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 9)
iAV119-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 10)
iAV1110-VS421114
AAV Packaging at 1011 GC/ml Titer (Serotype 11)
iAV1111-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 1)
iAV121-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 2)
iAV122-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 3)
iAV123-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 4)
iAV124-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 5)
iAV125-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 6)
iAV126-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 7)
iAV127-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 8)
iAV128-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 9)
iAV129-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 10)
iAV1210-VS421114
AAV Packaging at 1012 GC/ml Titer (Serotype 11)
iAV1211-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 1)
iAV131-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 2)
iAV132-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 3)
iAV133-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 4)
iAV134-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 5)
iAV135-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 6)
iAV136-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 7)
iAV137-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 8)
iAV138-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 9)
iAV139-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 10)
iAV1310-VS421114
AAV Packaging at 1013 GC/ml Titer (Serotype 11)
iAV1311-VS421114
;