HDAC2 siRNA AAV Vector Set (Human)
HDAC2 CRISPR
HDAC2 Lentiviral
HDAC2 AAV
HDAC2 Adenovirus
HDAC2 ORF
HDAC2 siRNA
-
Retired Cat.No.
23130161 -
Product Name
HDAC2 siRNA AAV Vector Set (Human) -
Unit
4 x 500 ng DNA -
Description
abm's RNAi expression vectors and viruses are ready-to-use tools for siRNA-mediated gene knockdown. Each product set includes four pre-designed siRNA vectors targeting your gene’s mRNA to ensure effective gene silencing. Both siRNA and shRNA constructs are available with the shRNA option accessible through the DNA Preparation Options. For added flexibility, our siRNA/shRNA vectors and viruses are also available in Lentivirus and AAV formats. -
Gene Name/Gene ID
HDAC2, 3066 -
Gene Full Name
histone deacetylase 2 -
Alias
RPD3, YAF1 -
Accession Number
-
Species
Human -
System
AAV Vector -
Target Sequence
HDAC2-96:GCCTCATAGAATCCGCATG
HDAC2-440:AAGCATCAGGATTCTGTTACG
HDAC2-611:AATACTTTCCTGGCACAG
HDAC2-917:TCCGTAATGTTGCTCGATGTT -
Vector Size
6013 -
Storage Condition
Store AAV Vectors at -20°C. -
QC
Restriction enzyme digest and sequencing. -
Disclaimer
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Search CoA here
Supporting Protocol
Publishing research using VS123130? Please let us know so that we can cite the reference in this datasheet.
VS123130 has not been cited in any literature.
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
We recommend using abm’s 2nd Generation Packaging System Mix (Cat. No. LV003) or 3rd Generation Packaging System Mix (Cat. No. LV053). abm’s lentiviral vectors have been tested and are compatible with Invitrogen’s packaging mix; we have not tested other suppliers and cannot guarantee compatibility.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Our scramble negative control can be used for human, mouse and rat. Please refer to abm’s Control Vectors and Viruses webpage for a full list.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
We recommend testing all 4 siRNA vectors. abm guarantees that at least one out of the four vector constructs purchased in a set will result in over 70% knockdown of gene expression within target cells showing >80% transfection efficiency.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
These vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop – this is to avoid any possible recombination events that can occur.
ABM Scientific Support
Answered on Mar 24 2025
Prev
Next
There are currently no reviews for VS123130.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
HDAC2 siRNA AAV Vector Set (Human)
Cat. No.
VS123130
Plasmid DNA Services
Upgrade to shRNA
1 Service
$150.00
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Virus Packaging Services
AAV packaging (Serotype 1) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 2) 1011 GC/ml ,pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 3) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 4) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 5) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 6) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 7) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 8) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 9) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 10) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 11) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 1) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 2) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 3) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 4) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 5) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 6) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 7) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 8) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 9) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 10) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 11) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 1) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 2) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 3) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 4) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 5) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 6) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 7) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 8) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 9) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 10) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 11) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV serotypes 3, 4, and 6 typically produce lower yields
compared to other serotypes.
As such, we can only guarantee 50% of the minimum titers
listed in the table above.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
Current vector selected:
HDAC2 siRNA AAV Vector Set (Human)
Cat. No.
VS123130
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
HDAC2 siRNA AAV Vector Set (Human)
VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 1)
iAV111-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 2)
iAV112-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 3)
iAV113-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 4)
iAV114-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 5)
iAV115-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 6)
iAV116-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 7)
iAV117-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 8)
iAV118-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 9)
iAV119-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 10)
iAV1110-VS123130
AAV Packaging at 1011 GC/ml Titer (Serotype 11)
iAV1111-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 1)
iAV121-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 2)
iAV122-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 3)
iAV123-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 4)
iAV124-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 5)
iAV125-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 6)
iAV126-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 7)
iAV127-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 8)
iAV128-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 9)
iAV129-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 10)
iAV1210-VS123130
AAV Packaging at 1012 GC/ml Titer (Serotype 11)
iAV1211-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 1)
iAV131-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 2)
iAV132-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 3)
iAV133-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 4)
iAV134-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 5)
iAV135-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 6)
iAV136-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 7)
iAV137-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 8)
iAV138-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 9)
iAV139-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 10)
iAV1310-VS123130
AAV Packaging at 1013 GC/ml Titer (Serotype 11)
iAV1311-VS123130