UBE2MP1 siRNA AAV Vector Set (Human)
UBE2MP1 CRISPR
UBE2MP1 Lentiviral
UBE2MP1 AAV
UBE2MP1 Adenovirus
UBE2MP1 ORF
UBE2MP1 siRNA
-
Retired Cat.No.
48986161 -
Product Name
UBE2MP1 siRNA AAV Vector Set (Human) -
Unit
4 x 500 ng DNA -
Description
abm's RNAi expression vectors and viruses are ready-to-use tools for siRNA-mediated gene knockdown. Each product set includes four pre-designed siRNA vectors targeting your gene’s mRNA to ensure effective gene silencing. Both siRNA and shRNA constructs are available with the shRNA option accessible through the DNA Preparation Options. For added flexibility, our siRNA/shRNA vectors and viruses are also available in Lentivirus and AAV formats. -
Gene Name/Gene ID
UBE2MP1, 606551 -
Gene Full Name
ubiquitin-conjugating enzyme E2M pseudogene 1 -
Accession Number
-
Species
Human -
System
AAV Vector -
Target Sequence
UBE2MP1-275: CCTGCCCAAGACGTGTGATATCAGCTTCT<br/>UBE2MP1-345: CCTGATGAGGGCTTCTACAAGAGTGGGAA<br/>UBE2MP1-531: ATAATTTATGGCCTGCAGTATCTCTACTT<br/>UBE2MP1-899: ACCCACTCAGCGATGGGAAATGAATTGGC -
Vector Size
6013 -
Storage Condition
Store AAV Vectors at -20°C. -
QC
Restriction enzyme digest and sequencing. -
Disclaimer
1. Disclaimer for accession number: The provided accession number refers to the transcript (mRNA) sequence the siRNA product targets. Please verify that this is the desired transcript sequence by cross-referencing. This is important because a single gene can have multiple different transcripts owing to naturally occurring variations. All sales are final. 2. Disclaimer for intended use: All of abm's vectors and viral particles are for research use ONLY and NOT for therapeutic/diagnostic applications. abm is not liable for any repercussions arising from the use of its vector(s) in therapeutic/diagnostic application(s). 3. Disclaimer for extra nucleotides: Cloning may lead to the insertion of extra nucleotides at the 5' or 3' end of the target sequence which, in most cases, is innocuous to the stability/functionality of the construct. -
Guarantee
Our RNA interference AAV vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop - to avoid any possible recombination events that can occur. ABM is confident that our pooled siRNA AAV vectors, when packaged into virus, will result in over 70% knockdown of gene expression within selected target cells showing 100% GFP expression. If this is not the case, we will provide a one-time, free replacement for a new pooled siRNA AAV vector expressing alternative siRNA sequences. To qualify for this replacement, the viruses must be used at a MOI >5,000 and the target cells selected and assayed 5-7 days post-infection. Customers must provide adequate data such as qPCR (using appropriate controls) to evaluate the level of gene expression. The replacement pooled siRNA AAV vector will not be covered by the same guarantee, and if this replacement is also considered to be ineffective then it is most likely the gene is not susceptible to siRNA knockdown. ABM limits its obligation and liability to providing one replacement of the pooled siRNA AAV vector product only, subject to a replacement fee. Before sending your inquiry, please make sure you have optimized your experiments as far as possible, this includes (where applicable) increasing your MOI and the duration of infection and carrying out clone screening before assaying for knockdown. Please send all replacement inquiries and experimental data to technical@abmgood.com -
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Search CoA here
Supporting Protocol
Publishing research using VS148986? Please let us know so that we can cite the reference in this datasheet.
VS148986 has not been cited in any literature.
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
We recommend using abm’s 2nd Generation Packaging System Mix (Cat. No. LV003) or 3rd Generation Packaging System Mix (Cat. No. LV053). abm’s lentiviral vectors have been tested and are compatible with Invitrogen’s packaging mix; we have not tested other suppliers and cannot guarantee compatibility.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Our scramble negative control can be used for human, mouse and rat. Please refer to abm’s Control Vectors and Viruses webpage for a full list.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
We recommend testing all 4 siRNA vectors. abm guarantees that at least one out of the four vector constructs purchased in a set will result in over 70% knockdown of gene expression within target cells showing >80% transfection efficiency.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
These vectors contain siRNAs. We employ a dual convergent promoter system where the sense and antisense strands of the siRNA are expressed by two different promoters rather than in a hairpin loop – this is to avoid any possible recombination events that can occur.
ABM Scientific Support
Answered on Mar 24 2025
Prev
Next
There are currently no reviews for VS148986.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
UBE2MP1 siRNA AAV Vector Set (Human)
Cat. No.
VS148986
Plasmid DNA Services
Upgrade to shRNA
1 Service
$150.00
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Virus Packaging Services
AAV packaging (Serotype 1) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 2) 1011 GC/ml ,pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 3) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 4) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 5) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 6) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 7) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 8) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 9) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 10) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 11) 1011 GC/ml, pooled siRNA (Supernatant) (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 1) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 2) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 3) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 4) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 5) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 6) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 7) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 8) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 9) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 10) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 11) 1012 GC/ml Titer (Gradient), pooled siRNA (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 1) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 2) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 3) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 4) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 5) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 6) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 7) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 8) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 9) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 10) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 11) 1013 GC/ml Titer (Ultra-pure), pooled siRNA (Add-on)
10 x 50 μl
$1,799.00
AAV serotypes 3, 4, and 6 typically produce lower yields
compared to other serotypes.
As such, we can only guarantee 50% of the minimum titers
listed in the table above.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
Current vector selected:
UBE2MP1 siRNA AAV Vector Set (Human)
Cat. No.
VS148986
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
qPCR AAV Titer Kit
G931
100 rxn
$212.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
Scrambled AAV siRNA Control Vector
iAAV01500
1.0 μg
$144.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
UBE2MP1 siRNA AAV Vector Set (Human)
VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 1)
iAV111-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 2)
iAV112-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 3)
iAV113-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 4)
iAV114-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 5)
iAV115-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 6)
iAV116-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 7)
iAV117-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 8)
iAV118-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 9)
iAV119-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 10)
iAV1110-VS148986
AAV Packaging at 1011 GC/ml Titer (Serotype 11)
iAV1111-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 1)
iAV121-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 2)
iAV122-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 3)
iAV123-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 4)
iAV124-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 5)
iAV125-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 6)
iAV126-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 7)
iAV127-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 8)
iAV128-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 9)
iAV129-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 10)
iAV1210-VS148986
AAV Packaging at 1012 GC/ml Titer (Serotype 11)
iAV1211-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 1)
iAV131-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 2)
iAV132-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 3)
iAV133-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 4)
iAV134-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 5)
iAV135-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 6)
iAV136-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 7)
iAV137-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 8)
iAV138-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 9)
iAV139-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 10)
iAV1310-VS148986
AAV Packaging at 1013 GC/ml Titer (Serotype 11)
iAV1311-VS148986