hsa-ACACA_0005 circRNA Non-Viral Vector

  • Retired Cat.No.

    69794181
  • Product Name

    hsa-ACACA_0005 circRNA Non-Viral Vector
  • Unit

    1.0 µg DNA
  • circRNA Name

    hsa_circ_0043256
  • circAtlas ID

    hsa-ACACA_0005
  • Host Gene

    ACACA
  • Description

    This circRNA non-viral vector can be used to over-express your circular RNA of interest by transfection into a wide variety of host cells.
  • Species

    Human
  • Chromosome

    chr17
  • Start Site

    37248011
  • End Site

    37253036
  • Strand

    -
  • Matured Sequence

    AAACATGGTGGTGGCTTTGAAGGAGCTGTCTATTCGGGGTGACTTTCGAA
    CTACAGTTGAATACCTGATCAAATTGTTAGAGACTGAAAGCTTTCAGATG
    AACAGAATTGATACTGGCTGGCTGGACAGACTGATAGCAGAAAAAGTACA
    GGCTGAGCGACCTGACACCATGTTGGGGGTTGTGTGTGGTGCCCTCCACG
    TGGCAGATGTGAGCCTGCGGAATAGCGTCTCTAACTTCCTTCACTCCTTA
    GAAAGGGGTCAAGTCCTTCCTGCTCATACACTTCTGAATACAGTAGATGT
    TGAACTTATCTATGAGGGAGTCAAGTATGTACTTAAGGTGACTCGACAGT
    CCCCCAACTCCTATGTGGTGATCATGAATGGCTCATGTGTAGAAGTAGAT
    GTACATCGGCTGAGTGACGGTGGACTGCTCTTGTCCTATGATGGCAGCAG
    TTATACTACGTATATGAAAGAGGAAGTGGATAG

  • Associated Diseases

    Non-small cell lung cancer
  • PMID

    28958934
  • System

    Non-Viral
  • Storage Condition

    Store Vectors at -20°C.
  • Disclaimer

  • Caution

    This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
    Publishing research using PR169794? Please let us know so that we can cite the reference in this datasheet.
    PR169794 has not been cited in any literature.
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    Typically vectors are supplied at 100ng/µl.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    These are both units used to measure the titer of AAV and can be used interchangeably. They are both based on qPCR methods.
    •GC/ml = Genome copies per milliliter, a physical titer that measures the number of genome-containing particles in a given volume.
    •vg/ml = Vector genomes per milliliter, a measure of the number of vector genomes in a given volume.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    It is possible that the incorrect AAV serotype was chosen. Serotype selection is an important parameter affecting transduction ability of AAV particles. In other words, you must determine which serotype works best for your cell line.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on May 13 2024
    ABM Scientific Support
    Answered on May 13 2024
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 28 2025
    Answer
    10^11 GC/ml = 1X PBS (pH 7.4)
    10^12, 10^13 GC/ml = 1X PBS (pH 7.4)+10% glycerol
    ABM Scientific Support
    Answered on Mar 28 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A general Plasmid Amplification Protocol can be found here.

    We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
    2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
    3. Place the plate “agar side up” and incubate at 37°C overnight.
    4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Mar 24 2025
    Answer
    AAV exhibits natural tropism towards certain cells and tissue types. Therefore your choice of AAV serotype should be dependent on the desired cell type. See our AAV Serotype Selection Chart at this link. Alternatively abm offers an AAV Serotype Blast Kit (Cat. No. AAV099) containing 9 pre-packaging helper-free AAV with GFP expression. This kit can be used to help the user determine a suitable serotype for their desired cell line.
    ABM Scientific Support
    Answered on Mar 24 2025
    ABM community
    Verified customer
    Asked on Jan 30 2026
    Answer
    A complete list of controls can be found on abm’s Control Vectors and Viruses page.
    ABM Scientific Support
    Answered on Jan 30 2026
    ABM community
    Verified customer
    Asked on Jan 29 2026
    Answer
    • Verify plasmid quality: Confirm the plasmid is intact, at sufficient concentration, and free of contaminants (e.g., salts, ethanol, nucleases).

    • Check the host strain: Use a suitable cloning strain (e.g., recA⁻/endA⁻ such as DH5α) and confirm cells are competent and not expired.

    • Confirm selection conditions: Make sure the correct antibiotic is used at the proper concentration and that plates/media are fresh.

    • Review transformation conditions: Ensure the transformation method (chemical or electrocompetent) and recovery time are appropriate.

    • Assess plasmid compatibility: Large, low-copy, toxic, or unstable plasmids may require specialized strains or growth conditions.

    • Inspect growth conditions: Verify incubation temperature, shaking speed, and culture time.

    • Check plasmid sequence/features: Look for toxic genes, strong promoters, or repeats that may reduce stability.

    ABM Scientific Support
    Answered on Jan 29 2026
    Prev
    Next
    There are currently no reviews for PR169794.
    Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
hsa-ACACA_0005 circRNA Non-Viral Vector
Cat. No.
PR169794
Plasmid DNA Services
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Controls and Related Products
Column-Pure RNA Miniprep Kit
D518
50 preparations
$307.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
circRNA Isolation Kit
G4001
25 Reactions
$550.00
BlasTaq™ 2X qPCR MasterMix
G891
500 rxn (4 x 1.25 ml)
$139.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
OneScript® Hot cDNA Synthesis Kit
G594
100 rxn
$207.00
Empty
×
Current vector selected:
Cat. No.
Controls and Related Products
Column-Pure RNA Miniprep Kit
D518
50 preparations
$307.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
circRNA Isolation Kit
G4001
25 Reactions
$550.00
BlasTaq™ 2X qPCR MasterMix
G891
500 rxn (4 x 1.25 ml)
$139.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
OneScript® Hot cDNA Synthesis Kit
G594
100 rxn
$207.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
;