hsa-RFWD3_0005 circRNA Non-Viral Vector
-
Retired Cat.No.
69771181 -
Product Name
hsa-RFWD3_0005 circRNA Non-Viral Vector -
Unit
1.0 µg DNA -
circRNA Name
hsa_circ_0004519 -
circAtlas ID
hsa-RFWD3_0005 -
Host Gene
RFWD3 -
Description
This circRNA non-viral vector can be used to over-express your circular RNA of interest by transfection into a wide variety of host cells. -
Species
Human -
Chromosome
chr16 -
Start Site
74636346 -
End Site
74637970 -
Strand
- -
Matured Sequence
TTCCCTACTGAAGGAACAGATGCTAAGGAAACAGGCCGAGTTAGAATCAG
CACAGTGCCGACTCCAACTGCAGGTCCTCACTGATAAGTGCACTAGGCTT
CAAAGGCGTGTTCAGGACTTGCAAAAACTTACGTCACATCAAAGTCAGAA
TTTACAGCAACCCAGGGGCTCCCAAGCATGGGTCCTGAGCTGCTCACCCT
CCAGCCAGGGCCAGCACAAGCACAAGTACCACTTCCAAAAGACCTTCACA
GTATCTCAGGCAGGAAACTGCCGGATCATGGCATACTGTGATGCTCTGAG
CTGCCTGGTGATATCACAGCCTTCTCCTCAGGCCTCTTTTCTTCCAG -
Associated Diseases
Esophageal cancer -
PMID
28618429 -
System
Non-Viral -
Storage Condition
Store Vectors at -20°C. -
Disclaimer
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Publishing research using PR169771? Please let us know so that we can cite the reference in this datasheet.
PR169771 has not been cited in any literature.
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Typically vectors are supplied at 100ng/µl.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
These are both units used to measure the titer of AAV and can be used interchangeably. They are both based on qPCR methods.
•GC/ml = Genome copies per milliliter, a physical titer that measures the number of genome-containing particles in a given volume.
•vg/ml = Vector genomes per milliliter, a measure of the number of vector genomes in a given volume.
•GC/ml = Genome copies per milliliter, a physical titer that measures the number of genome-containing particles in a given volume.
•vg/ml = Vector genomes per milliliter, a measure of the number of vector genomes in a given volume.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
It is possible that the incorrect AAV serotype was chosen. Serotype selection is an important parameter affecting transduction ability of AAV particles. In other words, you must determine which serotype works best for your cell line.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on May 13 2024
ABM Scientific Support
Answered on May 13 2024
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
We recommend storing abm’s vectors at -20°C and avoiding repeated freeze/thaws as this may affect plasmid integrity and cloning efficiency.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 28 2025
Answer
10^11 GC/ml = 1X PBS (pH 7.4)
10^12, 10^13 GC/ml = 1X PBS (pH 7.4)+10% glycerol
10^12, 10^13 GC/ml = 1X PBS (pH 7.4)+10% glycerol
ABM Scientific Support
Answered on Mar 28 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
A general Plasmid Amplification Protocol can be found here.
We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
We recommend transforming abm’s plasmids into our ProClone™ Competent Cells (Cat. No. E003). The ProClone™ Competent Cells are high-efficiency chemically competent DH5α (E. coli) cells ideal for routine plasmid amplification due to its high yield, rapid growth, and high transformation efficiency, with recA⁻ and endA⁻ mutations that ensure plasmid stability and high DNA quality. Other common compatible cloning strains include TOP10 (DH10B derivatives).
ABM Scientific Support
Answered on Jan 30 2026
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
1. Use a sterile loop or pipette tip to scrape a small amount of cells from the agar stab. Only a tiny amount is needed as it contains live E. coli.
2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
3. Place the plate “agar side up” and incubate at 37°C overnight.
4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
2. Gently streak the cells onto an agar plate containing the correct antibiotic selection in order to achieve single isolated colonies.
3. Place the plate “agar side up” and incubate at 37°C overnight.
4. Select a single colony from the plate for downstream applications, such as an overnight broth culture and grow E. coli to late exponential-early stationary phase. 4a. The broth culture can be subjected to miniprep plasmid extraction. We recommend using abm’s Column-Pure Plasmid Miniprep Kit (Cat. No. G4003). 4b. The broth culture can be used to prepare a glycerol stock for long-term storage. Mix culture with sterile glycerol to a final concentration of 15% and store at -80°C.
ABM Scientific Support
Answered on Jan 30 2026
Question
ABM community
Verified customer
Asked on Mar 24 2025
Answer
AAV exhibits natural tropism towards certain cells and tissue types. Therefore your choice of AAV serotype should be dependent on the desired cell type. See our AAV Serotype Selection Chart at this link. Alternatively abm offers an AAV Serotype Blast Kit (Cat. No. AAV099) containing 9 pre-packaging helper-free AAV with GFP expression. This kit can be used to help the user determine a suitable serotype for their desired cell line.
ABM Scientific Support
Answered on Mar 24 2025
Prev
Next
There are currently no reviews for PR169771.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
hsa-RFWD3_0005 circRNA Non-Viral Vector
Cat. No.
PR169771
Plasmid DNA Services
Midiprep Plasmid Amplification (Add-on)
10-20 µg
$75.00
Maxiprep Plasmid Amplification (Add-on)
80-100 µg
$150.00
Bacterial Agar Stab (Add-on)
1 stab
$40.00
Controls and Related Products
Column-Pure RNA Miniprep Kit
D518
50 preparations
$307.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
circRNA Isolation Kit
G4001
25 Reactions
$550.00
BlasTaq™ 2X qPCR MasterMix
G891
500 rxn (4 x 1.25 ml)
$139.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
OneScript® Hot cDNA Synthesis Kit
G594
100 rxn
$207.00
Empty
×
Current vector selected:
hsa-RFWD3_0005 circRNA Non-Viral Vector
Cat. No.
PR169771
Controls and Related Products
Column-Pure RNA Miniprep Kit
D518
50 preparations
$307.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
circRNA Isolation Kit
G4001
25 Reactions
$550.00
BlasTaq™ 2X qPCR MasterMix
G891
500 rxn (4 x 1.25 ml)
$139.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
OneScript® Hot cDNA Synthesis Kit
G594
100 rxn
$207.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
