Lenti-Bi-cistronic Vector
| Cat. No. | LV037 |
| Name | Lenti-Bi-cistronic Vector |
| Unit | 10 µg |
| Description |
Simultaneous expression of two or three genes by a single lentiviral vector is often required for a diverse range of applications. Until now, IRES-based elements were used for these particular applications. However, it has been well documented that the gene down-stream of IRES exhibits only low level transgene expression. In addition, the IRES element is relatively large in size (> 800bp) and its use is often limited due to the lentiviral packaging capability (<5.0kb). So development of a promoter system with bi-directional functionality was needed for simultaneous expression of two or three different genes by a single lentiviral vector. Now, ABM has developed such a system, the bicistronic vector, that is superior to IRES-based two gene expression systems because its smaller size (500bp) and stronger expression signal for both genes (Amendola et al., 2005), and with the addition of a T2A peptide to the tricistronic vector, up to 3 different genes can be expressed from the same lentiviral vector (Tang et al., 2009). |
| Storage Condition | Ice Pack |
| Note |
NOT FOR RESALE without prior written consent of ABM. This product is distributed for laboratory research only. |
| Material Citation | If use of this material results in a scientific publication, please cite the material in the following manner: Applied Biological Materials Inc, Cat. No. LV037 |
| What is the maximum size for the total inserts for this vector? | |
|
The size of the lentiviral vector is important for proper functionality. The total size of all the inserts for the bicistronic and tricistronic vectors cannot be over 4kb.
|
| For the left hand side with the mini-CMV promoter, is the information on the map already reversed to match the promoter direction? | |
|
The information is not reversed. So, Xmal is closest to the minCMV promoter, and AvrII is more distant.
|
| If I want to clone one insert only for the PGK promoter control, it is better to do it on the right or left side of the T2A peptide? | |
|
It is best to do it on the left side of T2A and remember to add a stop codon after the insert.
|
| If I want to clone two inserts for the PGK promoter control, do I need to remove the stop codon for the first insert to the left of the T2A peptide? | |
|
Yes, the stop codon has to be removed and please make sure the insert is in frame to the T2A.
|
| Is there any sequencing primer available for Tri-cistronic vector (LV038)? I am trying to sequence the inserts under both promoters. | |
|
FP_PGK:
GCACGCTTCAAAAGCGCAC
RP_minCMV
GAATTTATGTCGAGGTGGCGTG
|
| The ClaI cut site is not working on the Tricistronic Lentival Vector (LV038). Why is this happening? | |
|
The ClaI site overlaps with a Dam methylation site and is blocked by Dam methylation. If this site is to be used for cloning, the DNA must be transformed into a Dam-, Dcm- strain such as the Competent E.coli C2925H and isolate the plasmid DNA before proceeding with the ClaI digest. If possible, use a "friendlier" enzyme such as MfeI instead.
|
| Where are the polyadenylation signals in the vectors? | |
|
For Cat# LV037, one polyA sequence (AATAAA) is within the 3'LTR; the other polyA is between 5'LTR and MCS region of the miniCMV promoter. There is another SV40 poly A signal located at the end of the 3'LTR. It is designed this way to ensure a high amount of transcriptional RNA is present so that a high viral titer is obtained. Having a polyA signal upstream of the 3'LTR can cause premature RNA transcription and reduce the amount of transductionally active RNA. Lentivirus is an RNA virus and having a polyA signal may affect viral packaging, thus it is placed at the end of the 3'LTR. This 3'LTR can be found in other lentiviral vectors from abm and other companies as well.
For Cat# LV089, for the promoter in the reverse direction (minCMV), there is a SV40 poly A sequence (also in the reverse direction) at the end of the MCS, in addition to the one in the 3'LTR previously mentioned.
|
| Is the Dam methylation blocking the ClaI site in the bicistronic vector? | |
|
If you are using ClaI, you will need to propagate the plasmid in a dam-, dcm- strain of E.coli. Otherwise, the site will be blocked by Dam methylation.
|
| What restriction enzymes can be used to remove the puromycin resistant marker without altering the rest of the vector? | |
|
The SV40-Puro elements are flanked by MluI sites. They can use MluI to cut out the SV40-Puro fragment, and religate the vector together.
|
| What restriction enzymes can be used to remove the mini- CMV and PGK promoters on the bicistronics and tri-cistronics vectors to replace them by specific promoters without altering the rest of the vector? | |
|
This option is not available for this vector and we do not advise scientists to manipulate the vector outside the MCS as the downstream consequences are not supported. If you wish to use your own promoters, we can do a custom service design or recommend the following: http://abm.tonyblog.cn/Promoterless-Lentiviral-Vector.html
|
| Is abm's SV40 reverse sequencing primer the universal SV40 Reverse primer used in most sequencing facilities? | |
|
The SV40 reverse sequencing primer we list is a customized sequence that we use in house, and is not available in other sequencing facilities. Any primer sequence that is complementary to the SV40 promoter and will sequence in the reverse direction can be used to sequence the MCS of LV067 and LV073 however.
|
| If the poly A signal is embedded after the 3’LTR, while there is no poly A signal after the PGK-MCS, if an X gene is cloned in the MSC, the resulting mRNA will bear the X gene and the SV40 sequence until the polyA found in the 3’LTR? How will the X cloned gene be expressed as a single RNA starting at its own atg and stopping at its one stop codon if there is no poly A following? | |
|
The SV40 promoter and the puromycin selection marker will be present in the Gene X mRNA transcript. However, this will not affect the expression of Gene X. The polyA tail only acts to protect the mRNA from degradation. When translating the mRNA, the native start and stop codon of Gene X will still be responsible for initiating and terminating the translation of X. Once the ribosome hits the native stop codon of Gene X, termination of protein X translation will be signalled as normal.
|
| What is the luciferase in the pLenti-bicistronic-luc vector Cat#LV089? | |
|
The Luc is Firefly luciferase from Photinus pyralis.
|
| For Lenti-EF1a-GFP-2A-Puro Vector Cat# LV067, does it contain a transcription termination sequence before the SV40 promoter? | |
|
It does not contain a transcription termination sequence before the one located in the 3'LTR because having a transcription termination signal in the middle of the construct will impede viral packaging and cause a decrease in viral titer.
|
| With regards to Cat. No. LV038 Lenti-Tricistronic Vector, there is an HA tag to the right of the T2A peptide but there is a stop codon just right before the HA tag. Is there a way for the HA tag to be expressed? | |
|
The HA tag can't be expressed in the current format due to the location of the stop codon and the fact that there is no restriction enzyme site available to remove the stop codon.
If you wish to add an HA tag, you can consider adding it onto the end of the gene by PCR, and then cloning the gene-HA into the vector.
|
- Han, P et al. "Pituitary adenylate cyclase-activating polypeptide protects against β-amyloid toxicity" Neurobiol. Aging : (2014). DOI: 10.1016/j.neurobiolaging.2014.03.022. PubMed: 24726470. Application: Gene Expression.
- Li, FY et al. "Second messenger role for Mg2+ revealed by human T-cell immunodeficiency" Nature 475:471 - 6 (2011). DOI: 10.1038/nature10246. PubMed: 21796205. Application: Gene Expression.
- Brekman, A et al. "FOXJ1 Prevents Cilia Growth Inhibition by Cigarette Smoke in Human Airway Epithelium in Vitro" Am. J. Respir. Cell Mol. Biol. : 140514134921000 (2014). DOI: 10.1165/rcmb.2013-0363OC. PubMed: 24828273. Application: Control.
- Han, P et al. "Pituitary adenylate cyclase-activating polypeptide protects against β-amyloid toxicity" Neurobiol Aging 35(9):2064-2071 (2014). DOI: 10.1016/j.neurobiolaging.2014.03.022. PubMed: 24726470.
- Bashyal, N., et al. (2022). Improving the Safety of Mesenchymal Stem Cell-Based Ex Vivo Therapy Using Herpes Simplex Virus Thymidine Kinase. Molecules and Cells, 45(7), 479–494. https://doi.org/10.14348/molcells.2022.5015
- Bashyal, N., Lee, T.-Y., Chang, D.-Y., Jung, J.-H., Kim, M. G., Acharya, R., Kim, S.-S., Oh, I.-H., & Suh-Kim, H. (2022). Improving the Safety of Mesenchymal Stem Cell-Based Ex Vivo Therapy Using Herpes Simplex Virus Thymidine Kinase. Molecules and Cells, 45(7), 479–494. https://doi.org/10.14348/molcells.2022.5015