ARAF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
ARAF CRISPR
ARAF Lentiviral
ARAF AAV
ARAF Adenovirus
ARAF ORF
ARAF siRNA
-
Retired Cat.No.
12234154 -
Product Name
ARAF CRISPR All-in-one AAV vector set (with saCas9)(Mouse) -
Unit
3x1.0μg DNA -
Description
abm's Knockout sgRNA vectors and viruses are ready to use in your CRISPR Gene Knockout experiment. These vector and virus products come as a set of three sgRNA targets which are designed to guide Cas9 to cleave exonic gDNA resulting in frameshift mutations and ultimately gene knockout. Available constructs include All-in-One (Cas9 and sgRNA expression) and sgRNA only (no Cas9 expression) – navigate to Custom Option to select the latter. Our CRISPR vectors and viruses are also available in a variety of formats including Lentivirus, AAV and Non-Viral. -
Gene Name/Gene ID
ARAF, 11836 -
Gene Full Name
v-raf murine sarcoma 3611 viral oncogene homolog -
Accession Number
-
Species
Mouse -
System
AAV Vector -
Target Sequence
21 GCTCAGCCCCACTAACAGGA
75 GCCTAACAAGCAACGCACAG
425 ACTCATGTCAACGCAGACGG -
Promoter
PGK-U6 -
Vector Size
7408 -
Storage Condition
Store AAV Vectors at -20°C. -
QC
Restriction Enzyme Digest and Sequencing -
Disclaimer
-
Guarantee
☛ View our CRISPR Workflow Guide to learn how to use our CRISPR KO products and identify key stages in delivery, selection, and screening.
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Publishing research using VG412234? Please let us know so that we can cite the reference in this datasheet.
VG412234 has not been cited in any literature.
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Aug 08 2025
Answer
abm's lentiviral vectors are compatible with 2nd and 3rd generation packaging systems. We recommend abm’s Second Generation Packaging Mix (Cat. No. LV003) for users who want to achieve higher titer lentivirus as only 3 plasmids are required for virus production instead of 4 plasmids. We also recommend abm’s Third Generation Packaging Mix (Cat. No. LV053) for users concerned with virus biosafety, as the viral packaging elements are further split into 4 plasmids thus reducing probably of producing wild type virus.
Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
ABM Scientific Support
Answered on Aug 08 2025
Prev
Next
There are currently no reviews for VG412234.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
ARAF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
Cat. No.
VG412234
Plasmid DNA Services
Midiprep Plasmid Amplification (3 Plasmids) (Add-on)
10-20 µg each
$225.00
Maxiprep Plasmid Amplification (3 Plasmids) (Add-on)
80-100 µg each
$450.00
3 Bacterial Agar Stabs (Add-on)
3 stabs
$120.00
Virus Packaging Services
AAV packaging (Serotype 1) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 2) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 3) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 4) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 5) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 6) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 7) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 8) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 9) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 10) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 11) 1011 GC/ml Titer (Supernatant), 3 targets pooled (Add-on)
5 x 100 μl
$349.00
AAV packaging (Serotype 1) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 2) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 3) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 4) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 5) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 6) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 7) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 8) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 9) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 10) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 11) 1012 GC/ml Titer (Gradient), 3 targets pooled (Add-on)
5 x 200 μl
$879.00
AAV packaging (Serotype 1) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 2) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 3) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 4) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 5) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 6) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 7) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 8) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 9) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 10) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV packaging (Serotype 11) 1013 GC/ml Titer (Ultra-pure), 3 targets pooled (Add-on)
10 x 50 μl
$1,799.00
AAV serotypes 3, 4, and 6 typically produce lower yields
compared to other serotypes.
As such, we can only guarantee 50% of the minimum titers
listed in the table above.
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
Current vector selected:
ARAF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
Cat. No.
VG412234
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
ARAF CRISPR All-in-one AAV vector set (with saCas9)(Mouse)
VG412234
sgRNA only AAV vector set of 3 (for saCas9)
VG412234-AVgRNAsa
sgRNA only AAV vector set of 3 (for spCas9)
VG412234-AVgRNAsp
AAV Packaging at 1011 GC/ml Titer (Serotype 1)
CAV111-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 2)
CAV112-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 3)
CAV113-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 4)
CAV114-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 5)
CAV115-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 6)
CAV116-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 7)
CAV117-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 8)
CAV118-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 9)
CAV119-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 10)
CAV1110-VG412234
AAV Packaging at 1011 GC/ml Titer (Serotype 11)
CAV1111-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 1)
CAV121-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 2)
CAV122-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 3)
CAV123-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 4)
CAV124-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 5)
CAV125-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 6)
CAV126-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 7)
CAV127-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 8)
CAV128-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 9)
CAV129-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 10)
CAV1210-VG412234
AAV Packaging at 1012 GC/ml Titer (Serotype 11)
CAV1211-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 1)
CAV131-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 2)
CAV132-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 3)
CAV133-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 4)
CAV134-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 5)
CAV135-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 6)
CAV136-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 7)
CAV137-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 8)
CAV138-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 9)
CAV139-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 10)
CAV1310-VG412234
AAV Packaging at 1013 GC/ml Titer (Serotype 11)
CAV1311-VG412234