CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
-
Product Name
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9) -
Unit
1.0 µg -
Description
Control CRISPR Lentiviral Vector with scrambled sgRNA and spCas9.
-
Target Sequence
GCACTCACATCGCTACATCA -
Storage Condition
-20°C or below.
-
Disclaimer
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Prieto, K., Cao, Y., Mohamed, E., Trillo-Tinoco, J., Sierra, R. A., Urueña, C., … Barreto, A. "Polyphenol-rich extract induces apoptosis with immunogenic markers in melanoma cells through the ER stress-associated kinase PERK" Cell Death Discovery 5(1): (2019). DOI: 10.1038/s41420-019-0214-2.
Chakraborty, S., Bhat, A. M., Mushtaq, I., Luan, H., Kalluchi, A., Mirza, S., Storck, M. D., Chaturvedi, N., Lopez-Guerrero, J. A., Llombart-Bosch, A., Machado, I., Scotlandi, K., Meza, J. L., Ghosal, G., Coulter, D. W., Jordan Rowley, M., Band, V., Mohapatra, B. C., & Band, H. (2023). EHD1-dependent traffic of IGF-1 receptor to the cell surface is essential for Ewing sarcoma tumorigenesis and metastasis. Communications Biology, 6(1). https://doi.org/10.1038/s42003-023-05125-1
Harada, M., Su-Harada, K., Kimura, T., Ono, K., & Ashida, N. (2024). Sustained activation of NF-κB through constitutively active IKKβ leads to senescence bypass in murine dermal fibroblasts. Cell Cycle, 23(3), 308–327. https://doi.org/10.1080/15384101.2024.2325802
Li, Z., Hao, P., Zhao, Z., Gao, W., Huan, C., Li, L., Chen, X., Wang, H., Jin, N., Luo, Z.-Q., Li, C., & Zhang, W. (2023). The E3 ligase RNF5 restricts SARS-CoV-2 replication by targeting its envelope protein for degradation. Signal Transduction and Targeted Therapy, 8(1). https://doi.org/10.1038/s41392-023-01335-5
Lafita-Navarro, M. C., Hao, Y.-H., Jiang, C., Brown, I. N., Jang, S., Venkateswaran, N., Maurais, E., Stachera, W., Chang, T.-C., Mundy, D., Han, J., Tran, V. M., Mettlen, M., Woodruff, J. B., Mendell, J. T., Grishin, N. V., Kinch, L., Buszczak, M., & Conacci-Sorrell, M. (2022). ZNF692 organizes a hub for ribosome maturation enhancing translation in rapidly proliferating cells. https://doi.org/10.1101/2022.05.26.493655
Yamane, D., Feng, H., Rivera-Serrano, E. E., Selitsky, S. R., Hirai-Yuki, A., Das, A., McKnight, K. L., Misumi, I., Hensley, L., Lovell, W., González-López, O., Suzuki, R., Matsuda, M., Nakanishi, H., Ohto-Nakanishi, T., Hishiki, T., Wauthier, E., Oikawa, T., Morita, K., & Reid, L. M. (2019). Basal expression of interferon regulatory factor 1 drives intrinsic hepatocyte resistance to multiple RNA viruses. Nature Microbiology, 4(7), 1096–1104. https://doi.org/10.1038/s41564-019-0425-6
Shirasaki, T., Yamagoe, S., Shimakami, T., Murai, K., Imamura, R., Ishii, K.-A., Takayama, H., Matsumoto, Y., Tajima-Shirasaki, N., Nagata, N., Shimizu, R., Yamanaka, S., Abe, A., Omura, H., Kawaguchi, K., Okada, H., Yamashita, T., Yoshikawa, T., Takimoto, K., … Honda, M. (2022). Leukocyte cell-derived chemotaxin 2 is an antiviral regulator acting through the proto-oncogene MET. Nature Communications, 13(1). https://doi.org/10.1038/s41467-022-30879-3
Janneh, A. H., Kassir, M. F., Atilgan, F. C., Lee, H. G., Sheridan, M., Oleinik, N., ... & Ogretmen, B. (2022). Crosstalk between pro-survival sphingolipid metabolism and complement signaling induces inflammasome-mediated tumor metastasis. Cell Reports, 41(10), 111742. https://doi.org/10.1016/j.celrep.2022.111742
Baryła, I., Styczeń-Binkowska, E., Płuciennik, E., Kośla, K., & Bednarek, A. K. (2022). The WWOX/HIF1A Axis Downregulation Alters Glucose Metabolism and Predispose to Metabolic Disorders. International Journal of Molecular Sciences, 23(6), 3326. https://doi.org/10.3390/ijms23063326
Prodhomme, M. K., Pommier, R. M., Franchet, C., Frédérique Fauvet, Valérie Bergoglio, Brousset, P., Morel, A.-P., Anne-Cécile Brunac, Mojgan Devouassoux-Shisheboran, Petrilli, V., Moyret-Lalle, C., Hoffmann, J.-S., Alain Puisieux, & Agnès Tissier. (2020). EMT Transcription Factor ZEB1 Represses the Mutagenic POLθ-Mediated End-Joining Pathway in Breast Cancers. Cancer Research, 81(6), 1595–1606. https://doi.org/10.1158/0008-5472.can-20-2626
Chen, L.-M., Chai, Julius C., Liu, B., Strutt, Tara M., McKinstry, K. Kai, & Chai, Karl X. (2021). Prostasin regulates PD-L1 expression in human lung cancer cells. Bioscience Reports, 41(7). https://doi.org/10.1042/bsr20211370
Irene Lo Cigno, Federica Calati, Cinzia Borgogna, Zevini, A., Albertini, S., Martuscelli, L., Marco De Andrea, Hiscott, J., Landolfo, S., & Gariglio, M. (2020). Human Papillomavirus E7 Oncoprotein Subverts Host Innate Immunity via SUV39H1-Mediated Epigenetic Silencing of Immune Sensor Genes. Journal of Virology, 94(4). https://doi.org/10.1128/jvi.01812-19
Prieto, K., Cao, Y., Mohamed, E., Jimena Trillo-Tinoco, Sierra, R. A., Urueña, C., Sandoval, T. A., Fiorentino, S., Rodriguez, P. C., & Barreto, A. (2019). Polyphenol-rich extract induces apoptosis with immunogenic markers in melanoma cells through the ER stress-associated kinase PERK. Cell Death Discovery, 5(1). https://doi.org/10.1038/s41420-019-0214-2
Singh, A., Borah, A. K., Deka, K., Gogoi, A. P., Verma, K., Barah, P., & Saha, S. (2019). Arginylation regulates adipogenesis by regulating expression of PPARγ at transcript and protein level. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, 1864(4), 596–607. https://doi.org/10.1016/j.bbalip.2018.12.015
Taura, M., Song, E., Ho, Y.-C., & Iwasaki, A. (2019). Apobec3A maintains HIV-1 latency through recruitment of epigenetic silencing machinery to the long terminal repeat. Proceedings of the National Academy of Sciences of the United States of America, 116(6), 2282–2289. https://doi.org/10.1073/pnas.1819386116
YOHEI SEKINO, TAKESHI HAGURA, HAN, X., TAKASHI BABASAKI, GOTO, K., INOUE, S., HAYASHI, T., JUN TEISHIMA, SHIGETA, M., DAIKI TANIYAMA, KAZUYA KURAOKA, KAZUHIRO SENTANI, YASUI, W., & MATSUBARA, A. (2020). PTEN Is Involved in Sunitinib and Sorafenib Resistance in Renal Cell Carcinoma. Anticancer Research, 40(4), 1943–1951. https://doi.org/10.21873/anticanres.14149
Li, Z., Huan, C., Wang, H., Liu, Y., Liu, X., Su, X., Yu, J., Zhao, Z., Yu, X., Zheng, B., & Zhang, W. (2019). TRIM21‐mediated proteasomal degradation of SAMHD1 regulates its antiviral activity. EMBO Reports, 21(1). https://doi.org/10.15252/embr.201847528
Li, Z., Qu, X., Liu, X., Huan, C., Wang, H., Zhao, Z., Yang, X., Hua, S., & Zhang, W. (2020). GBP5 Is an Interferon-Induced Inhibitor of Respiratory Syncytial Virus. Journal of Virology, 94(21). https://doi.org/10.1128/jvi.01407-20
Sun, L.-F., Yang, Y.-L., Wang, M.-Y., Zhao, H.-S., Xiao, T., Li, M.-X., Wang, B.-B., Huang, C., Ren, P.-G., & Zhang, J. V. (2021). Inhibition of Col6a5 Improve Lipid Metabolism Disorder in Dihydrotestosterone-Induced Hyperandrogenic Mice. Frontiers in Cell and Developmental Biology, 9. https://doi.org/10.3389/fcell.2021.669189
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
We recommend using abm’s 2nd Generation Packaging System Mix (Cat. No. LV003) or 3rd Generation Packaging System Mix (Cat. No. LV053). abm’s lentiviral vectors have been tested and are compatible with Invitrogen’s packaging mix; we have not tested other suppliers and cannot guarantee compatibility.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Higher MOI will provide more copies of the antibiotic resistance gene per cell. Cells containing multiple copies of the resistance gene can withstand higher antibiotic concentrations compared to those at lower MOIs. The concentration of antibiotic should be adjusted to a level that will cause selection for the desired population of transduced cells without going below the minimum antibiotic concentration you have established in your killing curve.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
The standard RFP used in most of our vectors is mkate2. It has an excitation wavelength of 588nm and emission wavelength of 633nm.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI stands for multiplicity of infection. Theoretically, an MOI of 1 will provide 1 virus particle for each cell on a plate, while an MOI of 10 represents ten virus particles per cell. However, several factors can influence the optimal MOI including cell line, cell type, transduction efficiency and gene of interest. We recommend first establishing an optimal MOI for each cell line. This can be done using a range of MOIs (0, 0.5, 1, 2, 5, 10, 50) to determine the MOI required to obtain optimal gene expression
ABM Scientific Support
Answered on Jan 30 2026
There are currently no reviews for K010.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
Cat. No.
K010
Plasmid DNA Services
Midiprep Plasmid Amplification
10-20 µg
$75.00
Maxiprep Plasmid Amplification
80-100 µg
$150.00
Bacterial Agar Stab
1 stab
$40.00
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
Susfectin™ Transfection Reagent
G4000
1.0 ml
$245.00
AAViralEntry™ Transduction Enhancer (100X)
G516
1.0 ml
$190.00
AAV-CMV-Blank Control Vector
AAV001a
1 μg
$99.00
Empty
×
Current vector selected:
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
Cat. No.
K010
Controls and Related Products
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
Susfectin™ Transfection Reagent
G4000
1.0 ml
$245.00
AAViralEntry™ Transduction Enhancer (100X)
G516
1.0 ml
$190.00
AAV-CMV-Blank Control Vector
AAV001a
1 μg
$99.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?